b'Redefining Research & CareKidney Cancer in Adolescents Families with Kidney Cancer analysis of non-clear cell kidney tumors.inactivated in non-familial kidneyHereditary leiomyomatosis and renal The analysis studied 167 tumors fromUp to 5 percent of kidney cancers may becancers, it can also be inactivated in thecell cancer (HLRCC) syndrome (gene: patients at UT Southwestern, includ- hereditary. Simmons Cancer Center offers agermline. Familial VHL syndrome isFH) involves type 2 papillary RCC. Other ing six translocation carcinomas. Thefull suite of clinical genetics services. associated with clear cell RCC and renaltumors include benign smooth muscle Brugarolas and Seshagiri teams discov- cysts. Other tumors found in thesetumors in the skin and uterus (fibroids). ered that, like TFE3 and TFEB, the geneMost kidney cancers are sporadic, mean- patients include hemangioblastomasLynch syndrome (genes: MLH1, MSH2, MITF (which gives its name to the family)ing they occur randomly and for poorly(brain, spinal cord, retina), pheochromo- MSH6, PMS2, EPCAM) is associated was also translocated in renal can- understood reasons. But in some patientscytomas (adrenal gland), endolymphaticwith cancer of the renal pelvis. Other cer. They also found that genes in thisthese cancers are transmitted from parentssac tumors (inner ear), and neuroendo- tumors may include those in the colon, family can be activated through a newto offspring. This is typically due to thecrine tumors of the pancreas.uterus, and ovaries.mechanism: amplification. Amplificationtransmission of a mutated (faulty) gene inHereditary papillary renal cancerCowden syndrome (gene: PTEN) refers to an increase in the number ofthe sperm or the egg, a process referred to(HPRCC) (gene: MET) is associated withconfers an increased risk of RCC. These copies of a gene. These results haveas germline transmission. Warning signs oftype 1 papillary RCC. patients develop tumors in the breast, led UT Southwestern investigators tohereditary cancer include: Birt-Hogg-Dub (BHD) syndrome (gene:thyroid, and uterus. Other features propose a change in the name of thisYoung age (under 50) FLCN) is associated with oncocytic renalinclude macrocephaly (large head) and entity to MITF family tumors. (Durinck etCancer in both kidneys tumors and often chromophobe RCC.mucocutaneous lesions (where skin al., Nat Genet, 2015) Multiple family members Other features include pulmonary cysts,meets mucous membranes). Kidney cancer types such as papillary orspontaneous pneumothorax (air buildupSDH-associated renal cancer (genes: A Mouse Model Paves chromophobe between the lung and chest wall), andSDHB, SDHC, SDHD, SDHA) is the Way for New Therapies skin lesions. associated with clear cell RCC. Other Photo Courtesy of Yipin Photography A major challenge in the field of trans- Cancer Genetics Services ACCCTTACCGTAATTTACCGTCTGATACCAlocation carcinomas has been the lackat Simmons Cancer CenterCCGTAATTTACCGCTTACCGTAATTTACCGof an optimal model. Such a modelAs North Texas largest clinical cancer Young runners fundraise in support of Joeys Wings (an organization dedicated to finding a cure forwould help unravel how MITF genesgenetics program, Simmons Cancer CenterACTTACCGTAATTTACCGCCTGACCTACCTtranslocation carcinomas), which supports the Kidney Cancer Program at UT Southwestern. cause kidney cancer and would aidsees more than 3,700 patients a year inCTACCGTAATTTACCGATTTACCGTAGGCAAdolescents are affected by an otherwiseresults in the abnormal activation of a groupin the development of new therapiesmore than 20 locations throughout DFW. InCTCTTACCGTAATTTACCGACCTCCTCCGAfor this uncommon cancer that lacksaddition, the program is accessible through rare type of kidney cancer: translocationof related genes referred to as the MITFtreatment options. Propelled by fundingtelemedicine to individuals who live in ruralACCCTTACCGTAATTTACCGTCTGATACCAcarcinomas. From the Latin trans, meaningfamily. The most prominent members of thefrom Joeys Wings, a nonprofit orga- counties. Expansion to underserved popu- CCGTAATTTACCGCTTACCGTAATTTACCGacross, as well as the English location,family are TFE3 and TFEB. nization, the Brugarolas lab recentlylations throughout Texas is supported by aACTTACCGTAATTTACCGCCTGACCTACCTthe term refers to a kidney cancer character- succeeded in developing such a mousegrant (over $6 million) from CPRIT.ized by the swapping of genetic informationNovel Types of model. In 2018, the project was awardedWith 13 board-certified cancer geneticCTACCGTAATTTACCGATTTACCGTAGGCAfrom one region of the genome to another.Translocation Carcinomasa competitive $1.1 million grant fromcounselors, the program has assisted moreCTCTTACCGTAATTTACCGACCTCCTCCGATypically, the information is exchangedIn 2015, UT Southwestern and Genentech CPRIT (Cancer Prevention and Researchthan 3,000 patients with hereditary cancerACCCTTACCGTAATTTACCGTCTGATACCAbetween two different chromosomes. Thisreported the first integrated genomicInstitute of Texas).syndromes. Family members are educated on risk of developing cancer and optionsCCGTAATTTACCGCTTACCGTAATTTACCGfor prevention, early detection, and treat- ACTTACCGTAATTTACCGCCTGACCTACCTment. For a referral, call 214-645-2563 orCTACCGTAATTTACCGATTTACCGTAGGCA2.0 1.5 1.0 email cancergenetics@utsw.edu.CTCTTACCGTAATTTACCGACCTCCTCCGACopy number ratioHereditary Kidney Cancer SyndromesACCCTTACCGTAATTTACCGTCTGATACCAMost familial cancer predisposing conditionsCCGTAATTTACCGCTTACCGTAATTTACCGare passed on to only 50 percent of theACTTACCGTAATTTACCGCCTGACCTACCTindividuals offspring.CTACCGTAATTTACCGATTTACCGTAGGCA40000000 40500000 41000000 41500000 42000000 42500000 43000000 These syndromes include the following: CTCTTACCGTAATTTACCGACCTCCTCCGAPosition chr6 tRCC (translocation renal cell carcinoma) that develops in a geneticallyvon Hippel-Lindau (VHL) disease (gene:ACTTACCGTAATTTACCGCCTGACCTACCTPlot showing a novel mechanism of TFEB activation involving geneengineered mouse model (left) looks like human tRCC (right). VHL)while the VHL gene is commonlyCTACCGTAATTTACCGATTTACCGTAGGCAamplification. Adapted from Durinck et al., Nat Genet, 2015. CTCTTACCGTAATTTACCGACCTCCTCCGA58 59'